Parameter
| Biomarker | Extracellular vesicles (evs) carry miR-122 | Full name | MicroRNA-122 carried by extracellular vesicles | Molecular Type | Nucleic acid (miRNA) |
|---|---|---|---|---|---|
| Molecular Formula | miR-122 (human): 22 nucleotides (sequence: UGGAGUGUGACAAUGGUGUUUG) | Molecular Weight | ~7.1 kDa | Core Functional Dimensions | Regulation of inflammation |
| Disease | Metabolic Associated Fatty Liver Disease (MASLD) | Disease Subtypes | / | ||
| Organ | Liver | Test Sample / Technology Platform | Serum EV (qPCR, sequencing) | ||
| Pathobiological Mechanisms | miR-122-5p in hepatocyte EV promotes macrophage M1 polarization and aggravates liver inflammation | ||||
| Clinical Availability Status | Research phase | ||||
| Notes and Dynamics | It can be used as a liquid biopsy marker for the early diagnosis of NASH and has great research potential | ||||