Parameter
| Biomarker | miR-155 | Full name | MicroRNA-155 | Molecular Type | Microrna (non-coding RNA) |
|---|---|---|---|---|---|
| Molecular Formula | Human miR-155: 23 nucleotides (sequence: UUAAUGCUAAUCGUGAUAGGGGU) | Molecular Weight | ~7.3 kDa | Core Functional Dimensions | Monitoring of immune inflammation regulation |
| Disease | Inflammatory Bowel Disease (IBD) | Disease Subtypes | / | ||
| Organ | Intestine | Test Sample / Technology Platform | Serum/stool (qRT-PCR, digital PCR, RNA sequencing, microfluidic chip) | ||
| Pathobiological Mechanisms | 1. It is mainly expressed in T cells and macrophages, and activates NF-κB and STAT3 pathways by targeting anti-inflammatory genes SOCS1 and SHIP1; (2) In the active stage of IBD, the expression in serum/feces was increased (2.8-fold in CD patients and 2.1-fold in UC patients), which promoted the differentiation of Th17 cells and the secretion of IL-17 and IL-23. Inhibition of miR-155 reduced intestinal immune cell infiltration and mucosal inflammation score by 50% (mouse model data). | ||||
| Clinical Availability Status | Clinical Translational Research | ||||
| Notes and Dynamics | 1. Antisense oligonucleotide (ASO) targeting miR-155 restored intestinal barrier integrity and increased occludin expression by 60% in DSS-induced colitis mice; 2. "miR-155+FC" combined detection chip is being developed for early warning of IBD recurrence, with a sensitivity of 89% | ||||