Parameter
| Biomarker | miR-146a | Full name | MicroRNA-146a | Molecular Type | Microrna (non-coding RNA) |
|---|---|---|---|---|---|
| Molecular Formula | Human miR-146a: 22 nucleotides (sequence: UGAGAACUGAAUUCCAUAGGCU) | Molecular Weight | ~7.0 kDa | Core Functional Dimensions | Monitoring of immune inflammation regulation |
| Disease | Inflammatory Bowel Disease (IBD) | Disease Subtypes | / | ||
| Organ | Intestine | Test Sample / Technology Platform | Serum/stool (qRT-PCR, digital PCR, RNA sequencing) | ||
| Pathobiological Mechanisms | 1. It is mainly expressed in monocytes and macrophages, and plays an anti-inflammatory role by inhibiting the NF-κB pathway by targeting TRAF6 and IRAK1; 2. IBD patients serum/faeces miR - 146 - a express lower (CD patients by 40%, reduce 35%) in patients with UC, lead to proinflammatory factor (IL - 6, TNF alpha) excessive secretion; Supplementation of miR-146a mimics reduced intestinal inflammation and disease activity score by 50% in DSS-induced colitis mice | ||||
| Clinical Availability Status | Clinical Translational Research | ||||
| Notes and Dynamics | (1) When the ratio of miR-146a to miR-155 was less than 0.5, the risk of non-response to anti-TNF therapy in CD patients increased by 2.8 times; Lipid nanoparticles coated miR-146a mimics can target the intestinal mucosa in a mouse model, and the anti-inflammatory effect lasted for 4 weeks | ||||