| Biomarker | GBA1 Mut | Full name | GBA1 Gene Mutation | Molecular Type | Nucleic Acid (DNA) |
| Molecular Formula | / | Molecular Weight | / | Core Functional Dimensions | Susceptibility/Risk, Diagnosis |
| Disease(or Constitution) | Parkinson's Disease | Disease Subtypes | / | ||
| Organ | Brain | Test Sample / Technology Platform | Peripheral Blood Genomic DNA | ||
| Pathobiological Mechanisms | GBA1 gene mutation leads to decreased glucocerebrosidase (GCase) activity, accumulation of lysosomal substrates glucosylceramide (GlcCer)/glucosylsphingosine (GlcSph), thereby hindering α-synuclein (α-synuclein) clearance; meanwhile, misfolded GCase induces endoplasmic reticulum stress and autophagy-lysosome pathway abnormalities, accelerating the death of dopaminergic neurons in the substantia nigra pars compacta. | ||||
| Clinical Availability Status | Clinically available (used for genetic screening of familial PD, clarifying the assessment of PD onset risk in GBA1 mutation carriers). | ||||
| Notes and Dynamics | Therapeutic cutting-edge: The small molecule chaperone Ambroxol is undergoing phase 3 clinical trials (ASPro-PD, NCT05778617); adeno-associated virus (AAV)-mediated GBA1 gene therapy is in phase 1/2a trial stage (PROPEL, NCT04127578). | ||||
| Biomarker | TERT Promoter Mut | Full name | TERT Promoter Mutation | Molecular Type | Gene Mutation |
| Molecular Formula | / | Molecular Weight | / | Core Functional Dimensions | Prognosis, Risk Stratification |
| Disease(or Constitution) | Meningioma | Disease Subtypes | WHO Grade II/III, Malignant Subtype | ||
| Organ | Brain, Meninges | Test Sample / Technology Platform | Tumor Tissue (Pyrosequencing, NGS) | ||
| Pathobiological Mechanisms | Enhances telomerase activity, maintains the unlimited proliferation capacity of tumor cells, and is associated with malignant progression. | ||||
| Clinical Availability Status | Under Clinical Validation | ||||
| Notes and Dynamics | An independent poor prognostic indicator regardless of WHO grade; the median progression time of mutant patients is shortened to 10 months. | ||||
| Biomarker | Faecalibacterium prausnitzii | Full name | Faecalibacterium prausnitzii | Molecular Type | Bacteria (Firmicutes) |
| Molecular Formula | Molecular Weight | Core Functional Dimensions | Monitoring of gut microbiota homeostasis | ||
| Disease(or Constitution) | Inflammatory Bowel Disease (IBD) | Disease Subtypes | UC and CD | ||
| Organ | Intestine | Test Sample / Technology Platform | Stool (16S rRNA sequencing, qPCR, metagenomic sequencing, and fluorescence in situ hybridization) | ||
| Pathobiological Mechanisms | (1) The main butyric acid-producing bacteria in the gut inhibit HDAC1 activity by producing butyric acid, down-regulate the NF-κB pathway, and reduce the release of IL-6 and TNF-α; (2) Significantly decreased abundance in IBD patients (decreased by 60% in CD patients and 45% in UC patients), leading to insufficient energy supply and impaired barrier repair capacity of intestinal mucosa; (3) Abundance is positively correlated with mucosal healing rate, and low abundance (< 1% of total gut microbiota) indicates a 2.5-fold increased risk of IBD recurrence | ||||
| Clinical Availability Status | Clinical Research Applications | ||||
| Notes and Dynamics | 1. When the abundance ratio of F. prausnitzii to E. coli > 0.8, the response rate of anti-TNF therapy in CD patients increased by 40% (Gut study, 2025); (2) The phase Ⅲ clinical trial (NCT05789214) of a probiotic formulation containing F. prausnitzii for remission maintenance in UC has been enrolled, and the preliminary results show that the remission rate increased by 28% | ||||
| Biomarker | pS129 α-Syn | Full name | Phosphorylated α-synuclein (S129) | Molecular Type | Protein(Modified Form) |
| Molecular Formula | / | Molecular Weight | / | Core Functional Dimensions | Diagnostic Differentiation |
| Disease(or Constitution) | Parkinson's Disease | Disease Subtypes | Sporadic PD, Familial PD | ||
| Organ | Brain | Test Sample / Technology Platform | CSF/Plasma/Erythrocytes (SIMOA, IP-MS, Western Blot) | ||
| Pathobiological Mechanisms | Hyperphosphorylation at the S129 site promotes α-syn aggregation and pathological spread. | ||||
| Clinical Availability Status | Clinical cutting-edge: Plasma testing specificity reaches 85%. | ||||
| Notes and Dynamics | Can distinguish PD from Multiple System Atrophy (MSA). | ||||
| Biomarker | Neutrophil-lymphocyte ratio (NLR) | Full name | Neutrophil-lymphocyte ratio | Molecular Type | Blood cell ratio (derived metric) |
| Molecular Formula | Molecular Weight | Core Functional Dimensions | Assessment of immune-inflammatory balance | ||
| Disease(or Constitution) | Inflammatory Bowel Disease (IBD) | Disease Subtypes | UC, CD | ||
| Organ | Intestine | Test Sample / Technology Platform | Whole blood (blood routine analyzer, neutrophil/lymphocyte count) | ||
| Pathobiological Mechanisms | 1. In inflammatory state, neutrophils increase (bone marrow hematopoietic activation) and lymphocytes decrease (immune depletion), which jointly lead to the increase of NLR; (2) Reflecting the imbalance of intestinal mucosal immune cells, when NLR > 3.0, the mucosal healing rate of UC patients decreased by 40%, and the risk of non-response to anti-TNF in CD patients increased by 2.3-fold; (3) Associated with intestinal barrier disruption, increased NLR was accompanied by decreased expression of tight junction proteins (occludin and claudin-1) | ||||
| Clinical Availability Status | Clinical routine application | ||||
| Notes and Dynamics | (1) Platelet-lymphocyte ratio (PLR) could improve the predictive accuracy of IBD treatment response from 65% to 79%; 2. The 2025 Meta-analysis showed that NLR > 4.5 was an independent risk factor for postoperative recurrence (Rutgeerts score ≥i2) in CD patients (HR=2.8). | ||||
| Biomarker | α-Syn | Full name | α-Synuclein(Total α-syn) | Molecular Type | Protein |
| Molecular Formula | / | Molecular Weight | / | Core Functional Dimensions | Early Diagnosis |
| Disease(or Constitution) | Parkinson's Disease | Disease Subtypes | Sporadic PD, Familial PD | ||
| Organ | Brain | Test Sample / Technology Platform | CSF/Plasma/Skin Biopsy (ELISA, SIMOA, WB) | ||
| Pathobiological Mechanisms | Abnormal aggregation forms Lewy bodies, disrupting the function of dopaminergic neurons. | ||||
| Clinical Availability Status | Research validation: Decreased CSF levels can distinguish PD from healthy individuals. | ||||
| Notes and Dynamics | Abnormal levels appear earlier in familial PD (SNCA mutation) patients. | ||||
| Biomarker | Fecal calprotectin (FC) | Full name | Fecal calprotectin | Molecular Type | Proteins (S100 family calcium-binding proteins) |
| Molecular Formula | Human calprotectin (S100A8/S100A9 heterodimer): C₁₈₄H₂₈₆N₄₈O₅₄S₄ | Molecular Weight | ~24 kDa | Core Functional Dimensions | Monitoring of local inflammation in the gut |
| Disease(or Constitution) | Inflammatory Bowel Disease (IBD) | Disease Subtypes | UC, CD | ||
| Organ | Intestine | Test Sample / Technology Platform | Stool (ELISA, immunochromatography, quantum dot immunoassay, POCT kit) | ||
| Pathobiological Mechanisms | (1) accounting for 60% of the cytoplasmic protein of neutrophils. During intestinal inflammation, neutrophils infiltrate the mucosa and release FC, which directly reflects the degree of mucosal neutrophil infiltration; (2) FC is stable in stool (no change in activity within 7 days at room temperature) and can penetrate the intestinal mucus layer. The level of FC is significantly correlated with the endoscopic inflammation score (Mayo and CDEIS) (r=0.83); 3. Inhibition of FC release can reduce intestinal inflammatory injury and mucosal permeability | ||||
| Clinical Availability Status | Clinical routine application | ||||
| Notes and Dynamics | 1. Cut-off value stratification: FC < 50μg/g ruled out active inflammation, 50-250μg/g suggested mild inflammation, and > 250μg/g confirmed active IBD; 2. Home self-test kits (such as IBDoc) have been approved in the European Union, which can enable patients to monitor at home and reduce the frequency of endoscopy by 30% | ||||
| Biomarker | C-reactive protein (CRP) | Full name | C-reactive protein | Molecular Type | Protein (acute phase reactive protein) |
| Molecular Formula | Human CRP: C₂₄₄H₃₇₆N₆₈O₇₆S₆ | Molecular Weight | ~25.1 kDa | Core Functional Dimensions | Assessment of systemic inflammatory status |
| Disease(or Constitution) | Inflammatory Bowel Disease (IBD) | Disease Subtypes | Ulcerative colitis (UC), Crohn's disease (CD) | ||
| Organ | Intestine | Test Sample / Technology Platform | Plasma/serum (immunoturbidimetric assay, ELISA, chemiluminescence assay) | ||
| Pathobiological Mechanisms | 1. It is synthesized by hepatocytes under the regulation of proinflammatory cytokines such as IL-6 and TNF-α, and rapidly increases within 4-6 hours of inflammatory activation in IBD; 2. Amplifying systemic inflammatory response by activating complement system (C1q/C3) and promoting phagocyte chemotaxis; (3) The level of CRP is positively correlated with the severity of intestinal mucosal inflammation. When CRP > 45mg/L, the risk of colectomy in CD patients increases by 3 times | ||||
| Clinical Availability Status | Clinical routine application | ||||
| Notes and Dynamics | (1) The Guideline for the diagnosis and Treatment of IBD recommended CRP combined with fecal calprotectin (FC) for the differential diagnosis of IBD and IBS, with a specificity of 91%. (2) The latest study showed that the dynamic change rate of CRP (≥50% within 2 weeks of treatment) could predict the 1-year sustained response rate of anti-TNF therapy with an accuracy of 78% | ||||
| Biomarker | Fatty acid pattern score | Full name | Fatty acid pattern score | Molecular Type | Lipids (fatty acids) |
| Molecular Formula | Molecular Weight | Core Functional Dimensions | Metabolic Risk prediction | ||
| Disease(or Constitution) | Metabolic Associated Fatty Liver Disease (MASLD) | Disease Subtypes | All subtypes (risk prediction) | ||
| Organ | Liver | Test Sample / Technology Platform | Plasma phospholipids (lipidomics mass spectrometry) | ||
| Pathobiological Mechanisms | Contains 27 fatty acids, which is negatively correlated with hepatic steatosis, AUC=0.86 | ||||
| Clinical Availability Status | In the study phase, part of the cohort was used for risk prediction | ||||
| Notes and Dynamics | It can be used for MASLD risk screening in the general population and has a certain application prospect | ||||
| Biomarker | Extracellular vesicles (evs) carry miR-122 | Full name | MicroRNA-122 carried by extracellular vesicles | Molecular Type | Nucleic acid (miRNA) |
| Molecular Formula | miR-122 (human): 22 nucleotides (sequence: UGGAGUGUGACAAUGGUGUUUG) | Molecular Weight | ~7.1 kDa | Core Functional Dimensions | Regulation of inflammation |
| Disease(or Constitution) | Metabolic Associated Fatty Liver Disease (MASLD) | Disease Subtypes | Non-Alcoholic Steatohepatitis (NASH) (early inflammation) | ||
| Organ | Liver | Test Sample / Technology Platform | Serum EV (qPCR, sequencing) | ||
| Pathobiological Mechanisms | miR-122-5p in hepatocyte EV promotes macrophage M1 polarization and aggravates liver inflammation | ||||
| Clinical Availability Status | Research phase | ||||
| Notes and Dynamics | It can be used as a liquid biopsy marker for the early diagnosis of NASH and has great research potential | ||||
| Biomarker | Angiopoietin-like protein 3 (ANGPTL3) | Full name | Angiopoietin-like protein 3 | Molecular Type | Protein |
| Molecular Formula | Human ANGPTL3: C₂₉₈H₄₇₄N₈₄O₉₀S₂ | Molecular Weight | ~66.4 kDa | Core Functional Dimensions | Regulation of lipoprotein metabolism |
| Disease(or Constitution) | Metabolic Associated Fatty Liver Disease (MASLD) | Disease Subtypes | Simple fatty liver, Non-Alcoholic Steatohepatitis (NASH) | ||
| Organ | Liver | Test Sample / Technology Platform | Serum (ELISA, mass spectrometry), hepatocytes (proteomics) | ||
| Pathobiological Mechanisms | ANGPTL3 deficiency alters lipoprotein lipidome, decreases CE and TG, increases PUfas associated lipids, and improves liver fat | ||||
| Clinical Availability Status | In the research phase, inhibitors (such as Evinacumab) are under clinical study | ||||
| Notes and Dynamics | It is a potential therapeutic target for metabolic MASLD, and the clinical research prospect of inhibitors is broad | ||||
| Biomarker | Procollagen type Ⅲ N-terminal peptide (PIIINP) | Full name | Procollagen type Ⅲ N-terminal peptide | Molecular Type | Protein (collagen precursor) |
| Molecular Formula | Human PIIINP: C₁₄₇H₂₃₁N₄₁O₄₆ | Molecular Weight | ~34.6 kDa | Core Functional Dimensions | Markers for collagen synthesis |
| Disease(or Constitution) | Metabolic Associated Fatty Liver Disease (MASLD) | Disease Subtypes | Liver fibrosis (all stages) | ||
| Organ | Liver | Test Sample / Technology Platform | Serum (ELISA) | ||
| Pathobiological Mechanisms | Hepatic stellate cells are activated, collagen synthesis is increased, and PIIINP is released into the blood, which is positively correlated with fibrosis stage | ||||
| Clinical Availability Status | It can be used clinically and is mostly used for scientific research and curative effect monitoring | ||||
| Notes and Dynamics | It can directly reflect collagen synthesis, and combined with other indicators can improve the diagnostic accuracy | ||||
| Biomarker | Fibroblast growth factor-21 (FGF-21) | Full name | Fibroblast growth factor-21 | Molecular Type | Cytokines |
| Molecular Formula | Human FGF-21: C₁₀₈₃H₁697N₂97O₃21S₇ | Molecular Weight | ~22.1 kDa | Core Functional Dimensions | Metabolic regulation, anti-inflammatory |
| Disease(or Constitution) | Metabolic Associated Fatty Liver Disease (MASLD) | Disease Subtypes | Non-Alcoholic Steatohepatitis (NASH), Liver fibrosis | ||
| Organ | Liver | Test Sample / Technology Platform | Serum (ELISA, mass spectrometry) | ||
| Pathobiological Mechanisms | Hepatocyte stress secreted FGF-21, which was higher in NASH patients (SMD=1.30), reflecting metabolic disorder and inflammation | ||||
| Clinical Availability Status | In the research phase, a phase Ⅲ clinical trial (efruxifermin) is ongoing | ||||
| Notes and Dynamics | FGF-21 is a potential therapeutic target for NASH, and the clinical research progress of FGF-21 analogues is worthy of attention | ||||
| Biomarker | Neutrophil percentage-albumin ratio (NPAR) | Full name | Neutrophil percentage-albumin ratio | Molecular Type | A composite measure of inflammation/nutrition |
| Molecular Formula | Molecular Weight | Core Functional Dimensions | Inflammation and hepatic synthetic function | ||
| Disease(or Constitution) | Metabolic Associated Fatty Liver Disease (MASLD) | Disease Subtypes | All subtypes (inflammation/nutrition assessment) | ||
| Organ | Liver | Test Sample / Technology Platform | Serum (blood routine, biochemical tests) | ||
| Pathobiological Mechanisms | Increased neutrophils (inflammation) and decreased albumin (impaired liver synthesis), SMD=0.28, AUC=76.05% | ||||
| Clinical Availability Status | It is clinically available and easy to be carried out in primary hospitals | ||||
| Notes and Dynamics | It is low cost, easy to operate, and suitable for large-scale screening | ||||
| Biomarker | Triglyceride (TG) | Full name | Triglyceride | Molecular Type | Lipids (triglycerides) |
| Molecular Formula | C₃H₅(OOC-R)₃ (R = fatty acid chain, e.g., palmitic acid: C₁₆H₃₂O₂) | Molecular Weight | Varies by fatty acid chain (e.g., triolein: ~885 Da) | Core Functional Dimensions | Energy storage, lipoprotein transport |
| Disease(or Constitution) | Metabolic Associated Fatty Liver Disease (MASLD) | Disease Subtypes | Simple fatty liver, Non-Alcoholic Steatohepatitis (NASH) | ||
| Organ | Liver | Test Sample / Technology Platform | Plasma (lipid detection, lipidomics mass spectrometry), liver tissue (lipidomics mass spectrometry) | ||
| Pathobiological Mechanisms | De novo synthesis and peripheral fat mobilization in the liver are increased, and the proportion of specific VLDL-TG species is high, which promotes liver fat accumulation | ||||
| Clinical Availability Status | Plasma (lipid detection, lipidomics mass spectrometry), liver tissue (lipidomics mass spectrometry) | ||||
| Notes and Dynamics | Clinical routine test indicators, TG lowering drugs can improve liver fat, but long-term monitoring is needed | ||||
| Biomarker | Phosphatidylcholine (PC) | Full name | Phosphatidylcholine | Molecular Type | Lipids (phospholipids) |
| Molecular Formula | Varies by fatty acid chain (e.g., PC 36:3: C₄₂H₈₀NO₈P) | Molecular Weight | Varies by fatty acid chain (e.g., PC 36:3: ~758 Da) | Core Functional Dimensions | Membrane structure maintenance, lipoprotein assembly |
| Disease(or Constitution) | Metabolic Associated Fatty Liver Disease (MASLD) | Disease Subtypes | Simple fatty liver, Non-Alcoholic Steatohepatitis (NASH) | ||
| Organ | Liver | Test Sample / Technology Platform | Liver tissue (lipidomic mass spectrometry), plasma (lipidomic mass spectrometry) | ||
| Pathobiological Mechanisms | Decreased PC synthesis in liver tissue and increased plasma PC isoforms, such as PC (36:3), affect VLDL assembly and secretion | ||||
| Clinical Availability Status | Research Phase | ||||
| Notes and Dynamics | PC analogues have shown anti-steatosis effects in animal models and are of research value | ||||