| Biomarker | UA | Full name | Uric Acid | Molecular Type | Metabolite |
| Molecular Formula | C5H4N4O3 | Molecular Weight | 168.11 g/mol | Core Functional Dimensions | Risk Stratification |
| Disease(or Constitution) | Parkinson's Disease | Disease Subtypes | Sporadic PD, Familial PD | ||
| Organ | Brain | Test Sample / Technology Platform | Plasma (Uric Acid Kit, HPLC) | ||
| Pathobiological Mechanisms | Resists oxidative stress; decreased levels lead to increased vulnerability of dopaminergic neurons. | ||||
| Clinical Availability Status | Research validation: Plasma levels in PD patients are 25% lower than those in healthy individuals. | ||||
| Notes and Dynamics | Can be used as a non-invasive indicator for PD risk screening. | ||||
| Biomarker | hsCRP | Full name | High-Sensitivity C-Reactive Protein | Molecular Type | Inflammatory Factor |
| Molecular Formula | / | Molecular Weight | / | Core Functional Dimensions | Risk Stratification |
| Disease(or Constitution) | Parkinson's Disease | Disease Subtypes | Sporadic PD, Familial PD | ||
| Organ | Brain | Test Sample / Technology Platform | Plasma (Immunoturbidimetry, ELISA) | ||
| Pathobiological Mechanisms | Reflects systemic inflammation; elevated levels increase PD onset risk. | ||||
| Clinical Availability Status | Clinically available: Routine inflammatory screening indicator. | ||||
| Notes and Dynamics | Individuals with hsCRP > 3mg/L have an 1.8-fold increased risk of PD. | ||||
| Biomarker | RANTES | Full name | Chemokine RANTES | Molecular Type | Cytokine |
| Molecular Formula | / | Molecular Weight | / | Core Functional Dimensions | Pathological Confirmation |
| Disease(or Constitution) | Parkinson's Disease | Disease Subtypes | Sporadic PD, Familial PD | ||
| Organ | Brain | Test Sample / Technology Platform | Serum (ELISA, Luminex) | ||
| Pathobiological Mechanisms | Recruits immune cells to inflammatory foci, promoting neuroinflammation spread. | ||||
| Clinical Availability Status | Research exploration: Serum levels are positively correlated with H-Y stage in PD patients. | ||||
| Notes and Dynamics | No disease specificity, needs to be used in combination with PD-specific biomarkers. | ||||
| Biomarker | TNF-α | Full name | Tumor Necrosis Factor-α | Molecular Type | Cytokine |
| Molecular Formula | / | Molecular Weight | / | Core Functional Dimensions | Pathological Confirmation |
| Disease(or Constitution) | Parkinson's Disease | Disease Subtypes | Sporadic PD, Familial PD | ||
| Organ | Brain | Test Sample / Technology Platform | Serum/CSF (ELISA, Immunoassay) | ||
| Pathobiological Mechanisms | Activates microglia, inducing dopaminergic neuron apoptosis. | ||||
| Clinical Availability Status | Research validation: CSF levels in PD patients are positively correlated with substantia nigra neuron loss. | ||||
| Notes and Dynamics | Anti-TNF therapy can improve motor symptoms in PD models. | ||||
| Biomarker | IL-10 | Full name | Interleukin-10 | Molecular Type | Cytokine |
| Molecular Formula | / | Molecular Weight | / | Core Functional Dimensions | Pathological Confirmation |
| Disease(or Constitution) | Parkinson's Disease | Disease Subtypes | Sporadic PD, Familial PD | ||
| Organ | Brain | Test Sample / Technology Platform | Serum/CSF (ELISA, Luminex) | ||
| Pathobiological Mechanisms | An anti-inflammatory cytokine; decreased levels lead to inflammatory imbalance. | ||||
| Clinical Availability Status | Research exploration: Serum levels are negatively correlated with disease stage in PD patients. | ||||
| Notes and Dynamics | Exogenous supplementation can reduce neuroinflammation in PD models. | ||||
| Biomarker | IL-6 | Full name | Interleukin-6 | Molecular Type | Cytokine |
| Molecular Formula | / | Molecular Weight | / | Core Functional Dimensions | Pathological Confirmation |
| Disease(or Constitution) | Parkinson's Disease | Disease Subtypes | Sporadic PD, Familial PD | ||
| Organ | Brain | Test Sample / Technology Platform | Serum/CSF (ELISA, Luminex) | ||
| Pathobiological Mechanisms | Induces astrocyte activation, aggravating dopaminergic neuron injury. | ||||
| Clinical Availability Status | Research validation: CSF levels are significantly elevated in PD patients with dementia. | ||||
| Notes and Dynamics | Can be used as a quantitative indicator of PD inflammation degree. | ||||
| Biomarker | IL-1β | Full name | Interleukin-1β | Molecular Type | Cytokine |
| Molecular Formula | / | Molecular Weight | / | Core Functional Dimensions | Pathological Confirmation |
| Disease(or Constitution) | Parkinson's Disease | Disease Subtypes | Sporadic PD, Familial PD | ||
| Organ | Brain | Test Sample / Technology Platform | Serum/CSF (ELISA, Luminex) | ||
| Pathobiological Mechanisms | Secreted by activated microglia, activates the NF-κB pathway to promote neuroinflammation. | ||||
| Clinical Availability Status | Research validation: Serum levels in PD patients are 2 times higher. | ||||
| Notes and Dynamics | Positively correlated with the severity of PD motor symptoms. | ||||
| Biomarker | GCase | Full name | Glucocerebrosidase | Molecular Type | Enzyme |
| Molecular Formula | / | Molecular Weight | / | Core Functional Dimensions | Risk Stratification |
| Disease(or Constitution) | Parkinson's Disease | Disease Subtypes | Familial PD | ||
| Organ | Brain | Test Sample / Technology Platform | Plasma/Leukocytes (Enzyme Activity Assay, Sequencing) | ||
| Pathobiological Mechanisms | GBA1 mutation leads to decreased enzyme activity, affecting α-syn clearance. | ||||
| Clinical Availability Status | Clinically available: GBA1 gene testing is used for risk assessment of familial PD. | ||||
| Notes and Dynamics | Enzyme activators can improve PD model pathology. | ||||
| Biomarker | DJ-1 | Full name | DJ-1 Protein | Molecular Type | Protein |
| Molecular Formula | / | Molecular Weight | / | Core Functional Dimensions | Risk Stratification |
| Disease(or Constitution) | Parkinson's Disease | Disease Subtypes | Sporadic PD, Familial PD | ||
| Organ | Brain | Test Sample / Technology Platform | CSF/Plasma (ELISA, WB) | ||
| Pathobiological Mechanisms | Maintains mitochondrial function and resists oxidative stress; mutations increase PD susceptibility. | ||||
| Clinical Availability Status | Research exploration: CSF levels are decreased in PD patients. | ||||
| Notes and Dynamics | DJ-1 levels are lower in G2019S LRRK2 mutation carriers. | ||||
| Biomarker | IgG4 | Full name | Immunoglobulin G4 | Molecular Type | Immunoglobulin (Antibody subtype) |
| Molecular Formula | Human IgG4: C₆₃₂H₉８₄N₁₆₄O₁₉６S₈ | Molecular Weight | ~150 kDa | Core Functional Dimensions | Assessment of immune imbalance |
| Disease(or Constitution) | Inflammatory Bowel Disease (IBD) | Disease Subtypes | UC (combined with primary sclerosing cholangitis, PSC) | ||
| Organ | Intestine | Test Sample / Technology Platform | Serum/intestinal mucosal biopsy (ELISA, immunohistochemistry, flow cytometry, immunoblotting) | ||
| Pathobiological Mechanisms | 1. Abnormal activation of B cells inhibits complement activation and regulates Treg/Th17 balance by cross-reacting with intestinal mucosal antigens; (2) The serum IgG4 level of UC patients with PSC was significantly increased (≥175mg/dL), which indicated that the bile duct - intestinal immune cross-reaction was positively correlated with the degree of bile duct fibrosis (r=0.76). When intestinal mucosal IgG4 + plasma cell infiltration (> 50 / HPF), the risk of non-response to glucocorticoid in UC patients increased 3.1-fold | ||||
| Clinical Availability Status | Application in special clinical scenarios | ||||
| Notes and Dynamics | 1. IgG4 > 175mg/dL is a potential early warning indicator of cholangiocarcinoma in UC patients with PSC (Hepatology study 2025); 2. Rituximab (anti-CD20) can reduce the level of IgG4 in patients with UC-PSC, and preliminary clinical trials show that the remission rate of cholangitis is increased by 25% | ||||
| Biomarker | GFAP | Full name | Glial Fibrillary Acidic Protein | Molecular Type | Protein |
| Molecular Formula | / | Molecular Weight | / | Core Functional Dimensions | Pathological Confirmation |
| Disease(or Constitution) | Parkinson's Disease | Disease Subtypes | Sporadic PD, Familial PD | ||
| Organ | Brain | Test Sample / Technology Platform | Plasma/CSF (SIMOA, Immunoassay) | ||
| Pathobiological Mechanisms | A marker of astrocyte activation, responding to α-syn pathology and neuroinflammation | ||||
| Clinical Availability Status | Research validation: Plasma levels in PD patients are 30% higher than those in healthy individuals. | ||||
| Notes and Dynamics | Can predict cognitive decline in PD. | ||||
| Biomarker | NfL | Full name | Neurofilament Light Chain | Molecular Type | Protein |
| Molecular Formula | / | Molecular Weight | / | Core Functional Dimensions | Disease Monitoring |
| Disease(or Constitution) | Parkinson's Disease | Disease Subtypes | Sporadic PD, Familial PD | ||
| Organ | Brain | Test Sample / Technology Platform | CSF/Plasma (SIMOA, ELISA) | ||
| Pathobiological Mechanisms | Released after neuroaxonal injury, reflecting the degree of pan-neurodegeneration. | ||||
| Clinical Availability Status | Clinical monitoring tool: Used for efficacy assessment in clinical trials. | ||||
| Notes and Dynamics | Positively correlated with the progression rate of PD motor symptoms. | ||||
| Biomarker | Seeding-Competent α-Syn | Full name | Seeding-Competent α-Syn | Molecular Type | Protein (Aggregated Form) |
| Molecular Formula | / | Molecular Weight | / | Core Functional Dimensions | Early Diagnosis |
| Disease(or Constitution) | Parkinson's Disease | Disease Subtypes | Sporadic PD, Familial PD | ||
| Organ | Brain | Test Sample / Technology Platform | CSF/Skin/Colon Biopsy (RT-QuIC, PMCA) | ||
| Pathobiological Mechanisms | Amplified by RT-QuIC/PMCA, reflecting α-syn pathological activity. | ||||
| Clinical Availability Status | Clinical validation: Diagnostic sensitivity 92%, specificity 90%. | ||||
| Notes and Dynamics | Can predict the conversion of idiopathic Rapid Eye Movement Sleep Behavior Disorder (iRBD) to PD. | ||||
| Biomarker | CDKN2A/B Homozygous Del | Full name | CDKN2A/B Homozygous Deletion | Molecular Type | Chromosomal Abnormality |
| Molecular Formula | / | Molecular Weight | / | Core Functional Dimensions | Prognosis, Risk Stratification |
| Disease(or Constitution) | Meningioma | Disease Subtypes | WHO Grade III, Malignant Subtype | ||
| Organ | Brain, Meninges | Test Sample / Technology Platform | Tumor Tissue (FISH, CGH) | ||
| Pathobiological Mechanisms | Tumor suppressor gene deletion releases cell cycle regulation and promotes tumor proliferation. | ||||
| Clinical Availability Status | Under Clinical Validation | ||||
| Notes and Dynamics | Common in WHO Grade III meningiomas, indicating early recurrence risk; CDK4/6 inhibitors are a potential therapeutic direction. | ||||
| Biomarker | α-Syn (1-119/1-122) | Full name | α-Syn Truncated Forms (1-119/1-122) | Molecular Type | Protein(Truncated Form) |
| Molecular Formula | / | Molecular Weight | / | Core Functional Dimensions | Pathological Confirmation |
| Disease(or Constitution) | Parkinson's Disease | Disease Subtypes | Sporadic PD, Familial PD | ||
| Organ | Brain | Test Sample / Technology Platform | CSF/Brain Biopsy (MS/MS, WB) | ||
| Pathobiological Mechanisms | C-terminal truncation enhances α-syn fibrillation ability, aggravating neurotoxicity. | ||||
| Clinical Availability Status | Research exploration: Levels are elevated in CSF of PD patients. | ||||
| Notes and Dynamics | Positively correlated with Lewy body density. | ||||
| Biomarker | miR-155 | Full name | MicroRNA-155 | Molecular Type | Microrna (non-coding RNA) |
| Molecular Formula | Human miR-155: 23 nucleotides (sequence: UUAAUGCUAAUCGUGAUAGGGGU) | Molecular Weight | ~7.3 kDa | Core Functional Dimensions | Monitoring of immune inflammation regulation |
| Disease(or Constitution) | Inflammatory Bowel Disease (IBD) | Disease Subtypes | UC, CD | ||
| Organ | Intestine | Test Sample / Technology Platform | Serum/stool (qRT-PCR, digital PCR, RNA sequencing, microfluidic chip) | ||
| Pathobiological Mechanisms | 1. It is mainly expressed in T cells and macrophages, and activates NF-κB and STAT3 pathways by targeting anti-inflammatory genes SOCS1 and SHIP1; (2) In the active stage of IBD, the expression in serum/feces was increased (2.8-fold in CD patients and 2.1-fold in UC patients), which promoted the differentiation of Th17 cells and the secretion of IL-17 and IL-23. Inhibition of miR-155 reduced intestinal immune cell infiltration and mucosal inflammation score by 50% (mouse model data). | ||||
| Clinical Availability Status | Clinical Translational Research | ||||
| Notes and Dynamics | 1. Antisense oligonucleotide (ASO) targeting miR-155 restored intestinal barrier integrity and increased occludin expression by 60% in DSS-induced colitis mice; 2. "miR-155+FC" combined detection chip is being developed for early warning of IBD recurrence, with a sensitivity of 89% | ||||