| Biomarker | [11C]PK11195 (PET) | Full name | [11C]PK11195 (PET Imaging) | Molecular Type | Imaging Biomarker |
| Molecular Formula | / | Molecular Weight | / | Core Functional Dimensions | Pathological Confirmation |
| Disease(or Constitution) | Parkinson's Disease | Disease Subtypes | Sporadic PD, Familial PD | ||
| Organ | Brain | Test Sample / Technology Platform | Brain (PET Imaging) | ||
| Pathobiological Mechanisms | Binds to activated microglial TSPO, visualizing intracerebral neuroinflammation. | ||||
| Clinical Availability Status | Research application: Uptake is elevated in the substantia nigra of PD patients. | ||||
| Notes and Dynamics | Low resolution, needs to be used in combination with [18F]-FEPPA. | ||||
| Biomarker | Exo α-Syn | Full name | Exosomal α-synuclein | Molecular Type | Protein (Exosome-Associated) |
| Molecular Formula | / | Molecular Weight | / | Core Functional Dimensions | Early Diagnosis |
| Disease(or Constitution) | Parkinson's Disease | Disease Subtypes | Sporadic PD, Familial PD | ||
| Organ | Brain | Test Sample / Technology Platform | Plasma/CSF (Exosome Isolation + ELISA/SIMOA) | ||
| Pathobiological Mechanisms | Exosomes mediate intercellular transmission of α-syn, promoting pathological spread. | ||||
| Clinical Availability Status | Research cutting-edge: Non-invasive testing technology is in clinical trials. | ||||
| Notes and Dynamics | Positively correlated with PD disease stage. | ||||
| Biomarker | miR-124 | Full name | MicroRNA-124 | Molecular Type | Non-coding RNA (microRNA) |
| Molecular Formula | / | Molecular Weight | / | Core Functional Dimensions | Early Diagnosis |
| Disease(or Constitution) | Parkinson's Disease | Disease Subtypes | Sporadic PD, Familial PD | ||
| Organ | Brain | Test Sample / Technology Platform | Plasma/CSF (qPCR, RNA-seq) | ||
| Pathobiological Mechanisms | Inhibits BACE1 expression, regulates α-syn metabolism; levels are decreased in PD. | ||||
| Clinical Availability Status | Research exploration: Plasma levels in PD patients are 40% lower than those in healthy individuals. | ||||
| Notes and Dynamics | Exogenous miR-124 can reduce α-syn aggregation in PD models. | ||||
| Biomarker | SNCA Mut (A53T/A30P) | Full name | SNCA Mutants (A53T/A30P) | Molecular Type | Nucleic Acid (DNA) |
| Molecular Formula | / | Molecular Weight | / | Core Functional Dimensions | Risk Stratification |
| Disease(or Constitution) | Parkinson's Disease | Disease Subtypes | Familial PD | ||
| Organ | Brain | Test Sample / Technology Platform | Whole Blood (Gene Sequencing, PCR) | ||
| Pathobiological Mechanisms | Promotes α-syn aggregation, pathogenic mutations for familial PD. | ||||
| Clinical Availability Status | Clinically available: Used for genetic counseling of familial PD. | ||||
| Notes and Dynamics | A53T mutation carriers have higher CSF pS129 α-syn levels. | ||||
| Biomarker | miR-146a | Full name | MicroRNA-146a | Molecular Type | Microrna (non-coding RNA) |
| Molecular Formula | Human miR-146a: 22 nucleotides (sequence: UGAGAACUGAAUUCCAUAGGCU) | Molecular Weight | ~7.0 kDa | Core Functional Dimensions | Monitoring of immune inflammation regulation |
| Disease(or Constitution) | Inflammatory Bowel Disease (IBD) | Disease Subtypes | UC, CD | ||
| Organ | Intestine | Test Sample / Technology Platform | Serum/stool (qRT-PCR, digital PCR, RNA sequencing) | ||
| Pathobiological Mechanisms | 1. It is mainly expressed in monocytes and macrophages, and plays an anti-inflammatory role by inhibiting the NF-κB pathway by targeting TRAF6 and IRAK1; 2. IBD patients serum/faeces miR - 146 - a express lower (CD patients by 40%, reduce 35%) in patients with UC, lead to proinflammatory factor (IL - 6, TNF alpha) excessive secretion; Supplementation of miR-146a mimics reduced intestinal inflammation and disease activity score by 50% in DSS-induced colitis mice | ||||
| Clinical Availability Status | Clinical Translational Research | ||||
| Notes and Dynamics | (1) When the ratio of miR-146a to miR-155 was less than 0.5, the risk of non-response to anti-TNF therapy in CD patients increased by 2.8 times; Lipid nanoparticles coated miR-146a mimics can target the intestinal mucosa in a mouse model, and the anti-inflammatory effect lasted for 4 weeks | ||||
| Biomarker | Interleukin-6 (IL-6) | Full name | Interleukin-6 | Molecular Type | Proteins (proinflammatory cytokines) |
| Molecular Formula | Human IL-6: C₁₈₄H₂₈₇N₄₉O₅₇S | Molecular Weight | ~21 kDa | Core Functional Dimensions | Assessment of immune inflammatory activation |
| Disease(or Constitution) | Inflammatory Bowel Disease (IBD) | Disease Subtypes | UC, CD | ||
| Organ | Intestine | Test Sample / Technology Platform | Serum/intestinal mucosal biopsy (ELISA, chemiluminescence, flow cytometry) | ||
| Pathobiological Mechanisms | 1. It is secreted by macrophages and intestinal epithelial cells and activates the JAK/STAT3 pathway to promote B cell differentiation and acute phase response protein synthesis; (2) The level of serum IL-6 in active stage of IBD is increased (CD patients median 18pg/mL, UC patients median 15pg/mL, healthy people < 5pg/mL), which is positively correlated with the degree of intestinal mucosal inflammatory infiltration; The level of IL-6 could predict the response rate of IBD patients to tofacitinib (JAK inhibitor) with a sensitivity of 76% | ||||
| Clinical Availability Status | Clinical routine auxiliary application | ||||
| Notes and Dynamics | (1) IL-6 combined with CRP could improve the predictive accuracy of anti-IL-23 treatment response in CD patients (AUC=0.81); (2) The phase Ⅱ clinical trial of a novel IL-6 receptor antagonist (PMX-60056) in UC in 2025 showed that the mucosal healing rate increased by 30% | ||||
| Biomarker | LRRK2 Mut (G2019S/R1441G) | Full name | LRRK2 Mutants (G2019S/R1441G) | Molecular Type | Nucleic Acid (DNA) |
| Molecular Formula | / | Molecular Weight | / | Core Functional Dimensions | Risk Stratification |
| Disease(or Constitution) | Parkinson's Disease | Disease Subtypes | Familial PD | ||
| Organ | Brain | Test Sample / Technology Platform | Whole Blood (Gene Sequencing, PCR) | ||
| Pathobiological Mechanisms | Abnormal kinase activity leads to mitochondrial dysfunction and neuroinflammation. | ||||
| Clinical Availability Status | Clinical validation: A major pathogenic gene for familial PD. | ||||
| Notes and Dynamics | G2019S carriers can develop α-syn pathology 20 years in advance. | ||||
| Biomarker | Akkermansia muciniphila (Akk bacteria) | Full name | Akkermansia muciniphila | Molecular Type | Bacteria (Verrucomicrobia) |
| Molecular Formula | Molecular Weight | Core Functional Dimensions | Assessment of intestinal barrier function | ||
| Disease(or Constitution) | Inflammatory Bowel Disease (IBD) | Disease Subtypes | CD | ||
| Organ | Intestine | Test Sample / Technology Platform | Fecal/ileal mucosal biopsy (16S rRNA sequencing, qPCR, fluorescence in situ hybridization, metagenomic sequencing) | ||
| Pathobiological Mechanisms | 1. It can degrade intestinal mucus laminin (MUC2), produce SCFA such as acetic acid and propionic acid, and enhance the integrity of intestinal epithelial tight junctions (occludin and ZO-1); (2) The abundance of Akk bacteria in the ileum mucosa of CD patients decreased by 55% compared with that of healthy people, leading to the thinning of mucus layer (thickness < 5μm) and the increase of intestinal permeability; (3) The recovery of intestinal flora abundance (> 3% of total intestinal flora) was positively correlated with the duration of anti-TNF therapy in CD patients (r=0.68). | ||||
| Clinical Availability Status | Application in clinical research | ||||
| Notes and Dynamics | 1. The addition of an oral Akk bacterial formulation to infliximab increased the 1-year remission maintenance rate by 35% in CD patients (preliminary Cell Host Microbe data 2025); (2) A real-time Akk bacterial abundance monitoring chip is being developed, which can realize personalized adjustment of treatment regimens for CD patients and reduce ineffective treatment | ||||
| Biomarker | APOE ε4 | Full name | Apolipoprotein E ε4 | Molecular Type | Nucleic Acid (DNA) |
| Molecular Formula | / | Molecular Weight | / | Core Functional Dimensions | Risk Stratification |
| Disease(or Constitution) | Parkinson's Disease | Disease Subtypes | Sporadic PD, Familial PD | ||
| Organ | Brain | Test Sample / Technology Platform | Whole Blood (Genotyping, PCR) | ||
| Pathobiological Mechanisms | Affects α-syn clearance and lipid metabolism, increasing PD onset risk. | ||||
| Clinical Availability Status | Clinically available: Routine genetic testing item. | ||||
| Notes and Dynamics | ε4 homozygotes have a 3-fold increased risk of PD. | ||||
| Biomarker | KYN | Full name | Kynurenine | Molecular Type | Metabolite |
| Molecular Formula | C10H12N2O3 | Molecular Weight | 208.21 g/mol | Core Functional Dimensions | Pathological Confirmation |
| Disease(or Constitution) | Parkinson's Disease | Disease Subtypes | Sporadic PD, Familial PD | ||
| Organ | Brain | Test Sample / Technology Platform | Plasma/CSF (LC-MS, GC-MS) | ||
| Pathobiological Mechanisms | Kynurenine pathway imbalance produces the neurotoxic metabolite quinolinic acid. | ||||
| Clinical Availability Status | Research exploration: Levels in PD patients are positively correlated with neuroinflammation. | ||||
| Notes and Dynamics | Pathway inhibitors can reduce neuronal injury in PD models. | ||||
| Biomarker | Fecal lactoferrin (SL) | Full name | Fecal lactoferrin | Molecular Type | Protein (iron-binding glycoprotein) |
| Molecular Formula | Human lactoferrin: C₆₉₀H₁₁₁₂N₁８８O₂₀₀S₄ | Molecular Weight | ~80 kDa | Core Functional Dimensions | Monitoring of intestinal mucosal damage |
| Disease(or Constitution) | Inflammatory Bowel Disease (IBD) | Disease Subtypes | UC | ||
| Organ | Intestine | Test Sample / Technology Platform | Stool (ELISA, immunochromatography, POCT kit) | ||
| Pathobiological Mechanisms | 1. It is mainly derived from neutrophil secondary granules, which are released into the intestinal lumen with the infiltration of neutrophils during intestinal inflammation, directly reflecting the degree of mucosal injury; (2) There was a significant correlation between SL and the degree of mucosal erosion and ulcer under UC endoscopy (r=0.72). When SL > 7.5μg/g, the mucosal healing rate of UC patients decreased by 50%; (3) Strong stability (tolerance to 3 times freezing and thawing), high repeatability (CV < 10%), can replace some endoscopic examination | ||||
| Clinical Availability Status | Routine clinical application | ||||
| Notes and Dynamics | 1. The Consensus on Diagnosis and Treatment of UC in 2024 recommends SL as a monitoring index for UC in remission, and SL < 2μg/g indicates stable remission. (2) Frontier research integrated SL and gut microbiota data to develop a joint prediction model of "inflammation-microbiota", and the accuracy of UC recurrence prediction reached 82% | ||||
| Biomarker | PAG | Full name | Phenylacetylglutamine | Molecular Type | Metabolite |
| Molecular Formula | C11H14N2O3 | Molecular Weight | 222.24 g/mol | Core Functional Dimensions | Pathological Confirmation |
| Disease(or Constitution) | Parkinson's Disease | Disease Subtypes | Sporadic PD, Familial PD | ||
| Organ | Brain | Test Sample / Technology Platform | Plasma (LC-MS, GC-MS) | ||
| Pathobiological Mechanisms | Abnormal amino acid metabolism, involved in PD neurotoxic pathways. | ||||
| Clinical Availability Status | Research exploration: Plasma levels are elevated in PD patients. | ||||
| Notes and Dynamics | Positively correlated with the degree of PD cognitive impairment. | ||||
| Biomarker | High mobility group protein 1 (HMGB1) | Full name | High mobility group protein 1 | Molecular Type | Proteins (nuclear proteins) |
| Molecular Formula | Human HMGB1: C₁₈₀H₂８₄N₅₆O₅₄ | Molecular Weight | ~21.5 kDa | Core Functional Dimensions | Enlarged assessment of tissue damage with inflammation |
| Disease(or Constitution) | Inflammatory Bowel Disease (IBD) | Disease Subtypes | UC, CD | ||
| Organ | Intestine | Test Sample / Technology Platform | Serum/intestinal mucosal biopsy (ELISA, Western blot, immunohistochemistry, flow cytometry) | ||
| Pathobiological Mechanisms | 1. The necrotic/stressed cells are released into the extracellular space and activate the NF-κB and MAPK pathways by binding TLR4 and RAGE receptors to promote the secretion of IL-1β and TNF-α; (2) The levels of Il-1β and Tnf-α in serum and diseased mucosa of active IBD were increased (2.3-fold in UC patients and 2.7-fold in CD patients), which aggravated the destruction of intestinal mucosal barrier and increased intestinal permeability. (3) The level of HMGB1 was positively correlated with IBD disease activity score (CDAI, Mayo) (r=0.79), which could predict the risk of non-response to glucocorticoid therapy | ||||
| Clinical Availability Status | Clinical Research and Application | ||||
| Notes and Dynamics | 1. Glycyrrhizin, an HMGB1 inhibitor, reduced mucosal inflammation score by 50% and promoted mucosal healing in a UC mouse model; 2. HMGB1 monoclonal antibody (2 g7) Ⅰ in intractable CD phase of clinical trial (NCT05801234) showed that 35% lower disease activity 8 weeks, no serious adverse reactions | ||||
| Biomarker | Anti-saccharomyces cerevisiae Anti | Full name | Anti-saccharomyces cerevisiae Anti | Molecular Type | Immunoglobulin (IgG/IgA) |
| Molecular Formula | Human ASCA (IgG/IgA): C₆₃₂H₉８₄N₁₆₄O₁₉６S₈ (IgG), C₆₂０H₉６２N₁６０O₁９２S₈ (IgA) | Molecular Weight | ~150 kDa (IgG), ~160 kDa (IgA) | Core Functional Dimensions | Identification OF DISEASE subtypes |
| Disease(or Constitution) | Inflammatory Bowel Disease (IBD) | Disease Subtypes | Serum (ELISA, indirect immunofluorescence assay, chemiluminescence immunoassay) | ||
| Organ | Intestine | Test Sample / Technology Platform | Anti-saccharomyces cerevisiae Antibodies (ASCA) | ||
| Pathobiological Mechanisms | (1) 50-60% of CD patients (< 15% of UC patients) show positive autoantibodies against mannan in the cell wall of S. cerevisiae, which are associated with CD penetrating phenotypes such as ileal involvement and fistula formation; Activation of the complement system (classical pathway) aggravates intestinal mucosal injury. The endoscopic inflammation score (CDEIS) of ASCA positive CD patients is significantly higher than that of negative patients; The specificity of ASCA+/ P-ANCA-pattern in differentiating CD from UC was 92%, and the accuracy rate was 85% | ||||
| Clinical Availability Status | Clinical routine auxiliary application | ||||
| Notes and Dynamics | 1. Combined anti-OmpC and anti-Cbir1 antibodies could increase the diagnostic sensitivity of CD from 67% to 83% (Am J Gastroenterol Study, 2024); (2) When ASCA titer > 100U/mL, the endoscopic recurrence rate of CD patients one year after surgery increases by 40%, and it is recommended to strengthen follow-up monitoring | ||||
| Biomarker | ILA | Full name | Indolelactic Acid | Molecular Type | Metabolite |
| Molecular Formula | C9H9NO3 | Molecular Weight | 179.17 g/mol | Core Functional Dimensions | Pathological Confirmation |
| Disease(or Constitution) | Parkinson's Disease | Disease Subtypes | Sporadic PD, Familial PD | ||
| Organ | Brain | Test Sample / Technology Platform | Plasma (LC-MS, GC-MS) | ||
| Pathobiological Mechanisms | An intestinal flora metabolite; abnormal levels reflect gut-brain axis dysfunction. | ||||
| Clinical Availability Status | Research exploration: Plasma levels in PD patients are negatively correlated with intestinal flora diversity. | ||||
| Notes and Dynamics | Probiotic intervention can regulate its levels. | ||||
| Biomarker | FFA10:0/FFA12:0 | Full name | Free Fatty Acids (FFA10:0/FFA12:0) | Molecular Type | Metabolite |
| Molecular Formula | C10H20O2/C12H24O2 | Molecular Weight | 172.26/200.32 g/mol | Core Functional Dimensions | Early Diagnosis |
| Disease(or Constitution) | Parkinson's Disease | Disease Subtypes | Sporadic PD, Familial PD | ||
| Organ | Brain | Test Sample / Technology Platform | Plasma (LC-MS, GC-MS) | ||
| Pathobiological Mechanisms | Lipid metabolism imbalance affects α-syn aggregation and synaptic function. | ||||
| Clinical Availability Status | Research exploration: Plasma levels are significantly decreased in PD patients. | ||||
| Notes and Dynamics | Negatively correlated with PD motor score (UPDRS III). | ||||